Быстрый заказ

Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Человек C2ORF49 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001310
Размер кДНК:699bp
Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 2 open reading frame 49.
Синоним гена:asw, C2orf49
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with C2orf49 qPCR primers for gene expression analysis, HP102890 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14240-ACGRBS15400
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14240-ACRRBS15400
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14240-ANGRBS15400
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14240-ANRRBS15400
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14240-CFRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14240-CHRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14240-CMRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14240-CYRBS13340
Человек C2orf49 Джин клон кДНК в вектор клонированияHG14240-GRBS5130
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14240-NFRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14240-NHRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14240-NMRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14240-NYRBS13340
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмидыHG14240-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14240-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».