After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human C2ORF49 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001310
Размер кДНК:699bp
Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 2 open reading frame 49.
Синоним гена:asw, C2orf49
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14240-ACGRBS15396
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14240-ACRRBS15396
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14240-ANGRBS15396
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14240-ANRRBS15396
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14240-CFRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14240-CHRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14240-CMRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14240-CYRBS13343
Человек C2orf49 Джин клон кДНК в вектор клонированияHG14240-GRBS5132
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14240-NFRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14240-NHRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14240-NMRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14240-NYRBS13343
Человек C2orf49 Джин ORF экспрессии кДНК клона плазмидыHG14240-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14240-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».