After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human C2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000063.3
Размер кДНК:2259bp
Описание кДНК:Full length Clone DNA of Homo sapiens complement component 2 with N terminal Myc tag.
Синоним гена:C2, CO2, DKFZp779M0311
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10154-ACGRBS16764
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10154-ACRRBS16764
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10154-CFRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10154-CHRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10154-CMRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10154-CYRBS14711
Человек Complement Component C2 Джин клон кДНК в вектор клонированияHG10154-MRBS5132
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10154-M-FRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10154-NFRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10154-NHRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10154-NMRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10154-NYRBS14711
Человек Complement Component C2 Джин ORF экспрессии кДНК клона плазмидыHG10154-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Complement component C2 is part of the classical complement pathway which plays a major role in innate immunity against infection. C2 is a glycoprotein synthesized in liver hepatocytes and several other cell types in extrahepatic tissues. This pathway is triggered by a multimolecular complex C1, and subsequently the single-chain form of C2 is cleaved into two chains referred to C2a and C2b by activated C1. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. C4b and C2 was investigated by surface plasmon resonance. C2a containing a serine protease domain combines with complement component C4b to form the C3 convertase C4b2a which is responsible for C3 activation, and leads to the stimulation of adaptive immune responses via Lectin pathway. C2 bound to C4b is cleaved by classical (C1s) or lectin (MASP2) proteases to produce C4bC2a. C2 has the same serine protease domain as C4bC2a but in an inactive zymogen-like conformation, requiring cofactor-induced conformational change for activity. Deficiency of C2 (C2D) is the most common genetic deficiency of the complement system, and two types of C2D have been recognized in the context of specific MHC haplotypes. C2D in human is reported to increase susceptibility to infection, and is associated with certain autoimmune diseases, such as rheumatological disorders.

Ссылки
  • Laich A, et al. (2002) Complement C4bC2 complex formation: an investigation by surface plasmon resonance. Biochim Biophys Acta. 1544(1-2): 96-112.
  • Halili MA, et al. (2009) Complement component C2, inhibiting a latent serine protease in the classical pathway of complement activation. Biochemistry. 48(35): 8466-72.
  • Krishnan V, et al. (2009) The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation. Acta Crystallogr D Biol Crystallogr. 65(Pt 3): 266-74.
  • Size / Price
    Каталог: HG10154-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».