Быстрый заказ

Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек C1oRF56 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC002469
    Размер кДНК:1026bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 1 open reading frame 56.
    Синоним гена:RP11-316M1.9, C1orf56
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with C1oRF56 qPCR primers for gene expression analysis, HP102001 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13293-ACGRBS15400
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13293-ACRRBS15400
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13293-CFRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13293-CHRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13293-CMRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13293-CYRBS13340
    Человек C1oRF56 Джин клон кДНК в вектор клонированияHG13293-GRBS5130
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13293-NFRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13293-NHRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13293-NMRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13293-NYRBS13340
    Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмидыHG13293-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13293-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».