After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human C1oRF56 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC002469
Размер кДНК:1026bp
Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 1 open reading frame 56.
Синоним гена:RP11-316M1.9, C1orf56
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13293-ACGRBS15400
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13293-ACRRBS15400
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13293-CFRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13293-CHRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13293-CMRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13293-CYRBS13340
Человек C1oRF56 Джин клон кДНК в вектор клонированияHG13293-GRBS5130
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13293-NFRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13293-NHRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13293-NMRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13293-NYRBS13340
Человек C1oRF56 Джин ORF экспрессии кДНК клона плазмидыHG13293-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13293-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».