Быстрый заказ

Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек C1QTNF9 Информация о продукте «Клон cDNA»
    Размер кДНК:1002bp
    Описание кДНК:Full length Clone DNA of Homo sapiens C1q and tumor necrosis factor related protein 9 with N terminal Myc tag.
    Синоним гена:AQL1, CTRP9, C1QTNF9A, MGC48915, C1QTNF9
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with C1QTNF9 qPCR primers for gene expression analysis, HP102409 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13732-ACGRBS15400
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13732-ACRRBS15400
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13732-CFRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13732-CHRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13732-CMRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13732-CYRBS13340
    Человек CTRP9/C1QTNF9 Джин клон кДНК в вектор клонированияHG13732-GRBS5130
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13732-NFRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13732-NHRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13732-NMRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13732-NYRBS13340
    Человек CTRP9/C1QTNF9 Джин ORF экспрессии кДНК клона плазмидыHG13732-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.