Быстрый заказ

Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human C11ORF82 Информация о продукте «Клон cDNA»
Размер кДНК:2997bp
Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 11 open reading frame 82 with C terminal His tag.
Синоним гена:noxin, C11orf82
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13383-ACGRBS22238
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13383-ACRRBS22240
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13383-ANGRBS22238
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13383-ANRRBS22240
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13383-CFRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13383-CHRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13383-CMRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13383-CYRBS20185
Человек C11ORF82 Джин клон кДНК в вектор клонированияHG13383-GRBS5132
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13383-NFRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13383-NHRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13383-NMRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13383-NYRBS20185
Человек C11ORF82 Джин ORF экспрессии кДНК клона плазмидыHG13383-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13383-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.