Быстрый заказ

Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек C11ORF45 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC025756
    Размер кДНК:438bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 11 open reading frame 45 with C terminal HA tag.
    Синоним гена:C11ORF45
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with C11ORF45 qPCR primers for gene expression analysis, HP102146 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13446-ACGRBS15400
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13446-ACRRBS15400
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13446-CFRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13446-CHRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13446-CMRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13446-CYRBS13340
    Человек C11ORF45 Джин клон кДНК в вектор клонированияHG13446-GRBS5130
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13446-NFRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13446-NHRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13446-NMRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13446-NYRBS13340
    Человек C11ORF45 Джин ORF экспрессии кДНК клона плазмидыHG13446-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13446-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».