Быстрый заказ

Text Size:AAA

Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BTK Информация о продукте «Клон cDNA»
Размер кДНК:1980bp
Описание кДНК:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with C terminal Myc tag.
Синоним гена:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Участок рестрикции:KpnI + NotI (6kb + 2.03kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human BTK Gene Plasmid Map
Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10578-ACGRBS16760
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10578-ACRRBS16760
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10578-ANGRBS16760
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10578-ANRRBS16760
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10578-CFRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10578-CHRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10578-CMRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10578-CYRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин клон кДНК в вектор клонированияHG10578-MRBS5130
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10578-NFRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10578-NHRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10578-NMRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10578-NYRBS14710
Человек Bruton Tyrosine Kinase / BTK Kinase Джин ORF экспрессии кДНК клона плазмидыHG10578-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Каталог: HG10578-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.