Biglycan cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

Biglycan cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1107 bp
Description
Full length Clone DNA of Human biglycan with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Biglycan cDNA ORF Clone, Human, C-His tag: Alternative Names

DSPG1 cDNA ORF Clone, Human; PG-S1 cDNA ORF Clone, Human; PGI cDNA ORF Clone, Human; SLRR1A cDNA ORF Clone, Human

Biglycan Background Information

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.
Full Name
biglycan
References
  • Fisher L.W., et al.,(1989), Deduced protein sequence of bone small proteoglycan I (biglycan) shows homology with proteoglycan II (decorin) and several nonconnective tissue proteins in a variety of species. J. Biol. Chem. 264:4571-4576.
  • Fisher L.W., et al., (1991), Human biglycan gene. Putative promoter, intron-exon junctions, and chromosomal localization.J. Biol. Chem. 266:14371-14377.
  • Mallon A.-M., et al.,(2000), Comparative genome sequence analysis of the Bpa/Str region in mouse and man.Genome Res. 10:758-775.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait