After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BGN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001711.3
Размер кДНК:1107bp
Описание кДНК:Full length Clone DNA of Homo sapiens biglycan with C terminal His tag.
Синоним гена:PGI, DSPG1, PG-S1, SLRR1A, BGN
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10447-ACGRBS15400
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10447-ACRRBS15400
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10447-CFRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10447-CHRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10447-CMRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10447-CYRBS13340
Человек Biglycan Джин клон кДНК в вектор клонированияHG10447-MRBS5130
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10447-NFRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10447-NHRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10447-NMRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10447-NYRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмидыHG10447-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

Size / Price
Каталог: HG10447-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».