Быстрый заказ

Text Size:AAA

Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BGN Информация о продукте «Клон cDNA»
Размер кДНК:1107bp
Описание кДНК:Full length Clone DNA of Homo sapiens biglycan with C terminal His tag.
Синоним гена:PGI, DSPG1, PG-S1, SLRR1A, BGN
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10447-ACGRBS15400
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10447-ACRRBS15400
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10447-CFRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10447-CHRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10447-CMRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10447-CYRBS13340
Человек Biglycan Джин клон кДНК в вектор клонированияHG10447-MRBS5130
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10447-NFRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10447-NHRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10447-NMRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10447-NYRBS13340
Человек Biglycan Джин ORF экспрессии кДНК клона плазмидыHG10447-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

Size / Price
Каталог: HG10447-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.