Быстрый заказ

Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек BGN Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001711.3
    Размер кДНК:1107bp
    Описание кДНК:Full length Clone DNA of Homo sapiens biglycan with C terminal His tag.
    Синоним гена:PGI, DSPG1, PG-S1, SLRR1A, BGN
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BGN qPCR primers for gene expression analysis, HP100476 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10447-ACGRBS15400
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10447-ACRRBS15400
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10447-CFRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10447-CHRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10447-CMRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10447-CYRBS13340
    Человек Biglycan Джин клон кДНК в вектор клонированияHG10447-MRBS5130
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10447-NFRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10447-NHRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10447-NMRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10447-NYRBS13340
    Человек Biglycan Джин ORF экспрессии кДНК клона плазмидыHG10447-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.

    Size / Price
    Каталог: HG10447-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».