After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human BZW2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC003056
Размер кДНК:1260bp
Описание кДНК:Full length Clone DNA of Homo sapiens basic leucine zipper and W2 domains 2.
Синоним гена:HSPC028, MST017, MSTP017, BZW2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14262-ACGRBS15400
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14262-ACRRBS15400
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14262-ANGRBS15400
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14262-ANRRBS15400
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14262-CFRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14262-CHRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14262-CMRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14262-CYRBS13340
Человек BZW2 Джин клон кДНК в вектор клонированияHG14262-GRBS5130
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14262-NFRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14262-NHRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14262-NMRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14262-NYRBS13340
Человек BZW2 Джин ORF экспрессии кДНК клона плазмидыHG14262-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14262-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».