Быстрый заказ

Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек BZW2 Информация о продукте «Клон cDNA»
    Размер кДНК:1260bp
    Описание кДНК:Full length Clone DNA of Homo sapiens basic leucine zipper and W2 domains 2 with N terminal His tag.
    Синоним гена:HSPC028, MST017, MSTP017, BZW2
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with BZW2 qPCR primers for gene expression analysis, HP102912 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14262-ACGRBS15400
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14262-ACRRBS15400
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14262-ANGRBS15400
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14262-ANRRBS15400
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14262-CFRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14262-CHRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14262-CMRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14262-CYRBS13340
    Человек BZW2 Джин клон кДНК в вектор клонированияHG14262-GRBS5130
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14262-NFRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14262-NHRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14262-NMRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14262-NYRBS13340
    Человек BZW2 Джин ORF экспрессии кДНК клона плазмидыHG14262-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14262-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.