Быстрый заказ

Text Size:AAA

Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BUB3 Информация о продукте «Клон cDNA»
Размер кДНК:987bp
Описание кДНК:Full length Clone DNA of Homo sapiens POT1 protection of telomeres 1 homolog with C terminal Myc tag.
Синоним гена:hPot1, DKFZp586D211, POT1
Участок рестрикции:HindIII + XbaI (6kb + 1.03kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human BUB3 Gene Plasmid Map
Human BUB3 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11236-ACGRBS15400
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11236-ACRRBS15400
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11236-ANGRBS15400
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11236-ANRRBS15400
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11236-CFRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11236-CHRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11236-CMRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11236-CYRBS13340
Человек BUB3 Джин клон кДНК в вектор клонированияHG11236-MRBS5130
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11236-NFRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11236-NHRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11236-NMRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11236-NYRBS13340
Человек BUB3 Джин ORF экспрессии кДНК клона плазмидыHG11236-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11236-CM
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human BUB3 ORF mammalian expression plasmid, C-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.