BTN3A3 cDNA ORF Clone, Human, C-GFPSpark® tag

1/1
Price:
Size:
Number:

BTN3A3 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2484 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human butyrophilin, subfamily 3, member A3 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI(6kb+2.48kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BTN3A3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTN3A3 cDNA ORF Clone, Human, C-GFPSpark® tag: Validated Images

BTN3A3 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

BTF3 cDNA ORF Clone, Human; BTN3.3 cDNA ORF Clone, Human; BTN3A3 cDNA ORF Clone, Human

BTN3A3 Background Information

The three butyrophilin BTN3A molecules, BTN3A1, BTN3A2, and BTN3A3, are members of the B7/butyrophilin-like group of Ig superfamily receptors, which modulate the function of T cells. The butyrophilin 3 (BTN3) receptors are implicated in the T lymphocytes regulation and present a wide plasticity in mammals. A thorough phylogenetic analysis reveals a concerted evolution of BTN3 characterized by a strong and recurrent homogenization of the region encoding the signal peptide and the immunoglobulin variable (IgV) domain in Hominoids, where the sequences of BTN3A1 or BTN3A3 are replaced by BTN3A2 sequence.
Full Name
butyrophilin subfamily 3 member A3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait