After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BRIX1 Информация о продукте «Клон cDNA»
Размер кДНК:1062bp
Описание кДНК:Full length Clone DNA of Homo sapiens BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) with N terminal His tag.
Синоним гена:BRIX, BXDC2, FLJ11100, BRIX1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11391-ACGRBS15400
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11391-ACRRBS15400
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11391-ANGRBS15400
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11391-ANRRBS15400
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11391-CFRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11391-CHRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11391-CMRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11391-CYRBS13340
Человек BRIX1/BXDC2 Джин клон кДНК в вектор клонированияHG11391-MRBS5130
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11391-NFRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11391-NHRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11391-NMRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11391-NYRBS13340
Человек BRIX1/BXDC2 Джин ORF экспрессии кДНК клона плазмидыHG11391-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11391-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.