Быстрый заказ

Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек BPIFA3 Информация о продукте «Клон cDNA»
    Размер кДНК:657bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chromosome 20 open reading frame 71 with N terminal Myc tag.
    Синоним гена:SPLUNC3, C20orf71, MGC44525, BPIFA3
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with BPIFA3 qPCR primers for gene expression analysis, HP102405 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13728-ACGRBS15400
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13728-ACRRBS15400
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13728-CFRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13728-CHRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13728-CMRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13728-CYRBS13340
    Человек C20orf71 Джин клон кДНК в вектор клонированияHG13728-GRBS5130
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13728-NFRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13728-NHRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13728-NMRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13728-NYRBS13340
    Человек C20orf71 Джин ORF экспрессии кДНК клона плазмидыHG13728-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13728-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.