Быстрый заказ

Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек BPHL Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC106901
    Размер кДНК:825bp
    Описание кДНК:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal His tag.
    Синоним гена:MCNAA, BPH-RP, VACVASE
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BPHL qPCR primers for gene expression analysis, HP102354 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15763-ACGRBS15400
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15763-ACRRBS15400
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15763-CFRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15763-CHRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15763-CMRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15763-CYRBS13340
    Человек BPHL Джин клон кДНК в вектор клонированияHG15763-GRBS5130
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15763-NFRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15763-NHRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15763-NMRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15763-NYRBS13340
    Человек BPHL Джин ORF экспрессии кДНК клона плазмидыHG15763-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

    Ссылки
  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Каталог: HG15763-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».