Быстрый заказ

Text Size:AAA

Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BPHL Информация о продукте «Клон cDNA»
Размер кДНК:825bp
Описание кДНК:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal His tag.
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15763-ACGRBS15400
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15763-ACRRBS15400
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15763-CFRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15763-CHRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15763-CMRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15763-CYRBS13340
Человек BPHL Джин клон кДНК в вектор клонированияHG15763-GRBS5130
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15763-NFRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15763-NHRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15763-NMRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15763-NYRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмидыHG15763-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.