Быстрый заказ

Text Size:AAA

Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BPHL Информация о продукте «Клон cDNA»
Размер кДНК:825bp
Описание кДНК:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal HA tag.
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15763-ACGRBS15400
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15763-ACRRBS15400
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15763-CFRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15763-CHRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15763-CMRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15763-CYRBS13340
Человек BPHL Джин клон кДНК в вектор клонированияHG15763-GRBS5130
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15763-NFRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15763-NHRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15763-NMRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15763-NYRBS13340
Человек BPHL Джин ORF экспрессии кДНК клона плазмидыHG15763-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Каталог: HG15763-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.