Быстрый заказ

Text Size:AAA

Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BNIP1 Информация о продукте «Клон cDNA»
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Homo sapiens BCL2/adenovirus E1B 19kDa interacting protein 1 with N terminal Myc tag.
Синоним гена:NIP1, SEC20, TRG-8
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15457-ACGRBS15400
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15457-ACRRBS15400
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15457-CFRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15457-CHRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15457-CMRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15457-CYRBS13340
Человек BNIP1 Джин клон кДНК в вектор клонированияHG15457-GRBS5130
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15457-NFRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15457-NHRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15457-NMRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15457-NYRBS13340
Человек BNIP1 Джин ORF экспрессии кДНК клона плазмидыHG15457-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15457-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.