Быстрый заказ

Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек BNC2 Информация о продукте «Клон cDNA»
    Размер кДНК:3300bp
    Описание кДНК:Full length Clone DNA of Homo sapiens basonuclin 2 with N terminal Myc tag.
    Синоним гена:BSN2, FLJ20043, FLJ34928, DKFZp686A01127, BNC2
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with BNC2 qPCR primers for gene expression analysis, HP101705 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13088-ACGRBS22240
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13088-ACRRBS22240
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13088-ANGRBS22240
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13088-ANRRBS22240
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13088-CFRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13088-CHRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13088-CMRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13088-CYRBS20190
    Человек BNC2 Джин клон кДНК в вектор клонированияHG13088-GRBS5130
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13088-G-FRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13088-NFRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13088-NHRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13088-NMRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13088-NYRBS20190
    Человек BNC2 Джин ORF экспрессии кДНК клона плазмидыHG13088-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13088-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.