After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BMPR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001204.6
Размер кДНК:3117bp
Описание кДНК:Full length Clone DNA of Homo sapiens bone morphogenetic protein receptor, type I I (serine/threonine kinase) with N terminal Flag tag.
Синоним гена:BMR2, PPH1, BMPR3, BRK-3, T-ALK, BMPR-II, FLJ41585, FLJ76945
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-BMPR2
Участок рестрикции:KpnI + NotI (6kb + 3.13kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2820 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human BMPR2 Gene Plasmid Map
Human BMPR-II natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10551-ACGRBS22240
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10551-ACRRBS22240
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10551-CFRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10551-CHRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10551-CMRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10551-CYRBS20190
Человек BMPR2 Джин клон кДНК в вектор клонированияHG10551-MRBS5130
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10551-NFRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10551-NHRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10551-NMRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10551-NYRBS20190
Человек BMPR2 Джин ORF экспрессии кДНК клона плазмидыHG10551-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming growth factor (TGF)-beta/bone morphogenetic protein (BMP) superfamily. Reduced expression or function of BMPR2 signaling leads to exaggerated TGF-beta signaling and altered cellular responses to TGF-beta. In endothelial cells, BMPR2 mutation increases the susceptibility of cells to apoptosis. BMPR2 transduces BMP signals by forming heteromeric complexes with and phosphorylating BMP type I receptors. The intracellular domain of BMPR2 is both necessary and sufficient for receptor complex interaction. It had been identified that BMPR2 plays a key role in cell growth. Its mutations lead to hereditary pulmonary hypertension, and knockout of Bmpr-II results in early embryonic lethality. The C-terminal tail of BMPR2 provides binding sites for a number of regulatory proteins that may initiate Smad-independent signalling. BMPR2 mutations were predicted to alter the BMP and TGF-b1/SMAD signalling pathways, resulting in proliferation rather than apoptosis of vascular cells, and greatly increase the risk of developing severe pulmonary arterial hypertension. BMPR2 gene result in familial Primary pulmonary hypertension (PPH) transmitted as an autosomal dominant trait, albeit with low penetrance. Heterozygous germline mutations of BMPR2 gene have been identified in patients with familial and sporadic PPH, indicating that BMPR2 may contribute to the maintenance of normal pulmonary vascular structure and function. Tctex-1, a light chain of the motor complex dynein, interacts with the cytoplasmic domain of BMPR2 and demonstrate that Tctex-1 is phosphorylated by BMPR-II, a function disrupted by PPH disease causing mutations within exon 12. BMPR2 and Tctex-1 co-localize to endothelium and smooth muscle within the media of pulmonary arterioles, key sites of vascular remodelling in PPH.

Ссылки
  • Machado RD, et al. (2003) Functional interaction between BMPR-II and Tctex-1, a light chain of Dynein, is isoform-specific and disrupted by mutations underlying primary pulmonary hypertension. Hum Mol Genet. 12(24): 3277-86.
  • Abramowicz MJ, et al. (2003) Primary pulmonary hypertension after amfepramone (diethylpropion) with BMPR2 mutation. Eur Respir J. 22(3): 560-2.
  • Hassel S, et al. (2004) Proteins associated with type II bone morphogenetic protein receptor (BMPR-II) and identified by two-dimensional gel electrophoresis and mass spectrometry. Proteomics. 4(5): 1346-58.
  • Beppu H, et al. (2005) Generation of a floxed allele of the mouse BMP type II receptor gene. Genesis. 41(3): 133-7.
  • Morrell NW. (2006) Pulmonary hypertension due to BMPR2 mutation: a new paradigm for tissue remodeling? Proc Am Thorac Soc. 3(8): 680-6.
  • Nasim MT, et al. (2008) Stoichiometric imbalance in the receptor complex contributes to dysfunctional BMPR-II mediated signalling in pulmonary arterial hypertension. Hum Mol Genet. 217(11): 1683-94.
  •  

    BMPR2 related areas, pathways, and other information

    Size / Price
    Каталог: HG10551-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human BMPR-II natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».