Быстрый заказ

Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BMP4 Информация о продукте «Клон cDNA»
Размер кДНК:1227bp
Описание кДНК:Full length Clone DNA of Homo sapiens bone morphogenetic protein 4 with C terminal Myc tag.
Синоним гена:ZYME, BMP2B, BMP2B1, MCOPS6
Участок рестрикции:KpnI + XbaI (6kb + 1.27kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human BMP4 Gene Plasmid Map
Human BMP-4 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10609-ACGRBS15400
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10609-ACRRBS15400
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10609-CFRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10609-CHRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10609-CMRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10609-CYRBS13340
Человек BMP-4/BMP-2B Джин клон кДНК в вектор клонированияHG10609-GRBS5130
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10609-NFRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10609-NHRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10609-NMRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10609-NYRBS13340
Человек BMP-4/BMP-2B Джин ORF экспрессии кДНК клона плазмидыHG10609-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10609-CM
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human BMP-4 natural ORF mammalian expression plasmid, C-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.