Быстрый заказ

Text Size:AAA

Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BIRC5 Информация о продукте «Клон cDNA»
Размер кДНК:429bp
Описание кДНК:Full length Clone DNA of Homo sapiens baculoviral IAP repeat-containing 5, transcript variant 1 with C terminal Flag tag.
Синоним гена:API4, EPR-1
Участок рестрикции:KpnI + XbaI (6kb + 0.47kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human BIRC5 Gene Plasmid Map
Human BIRC5 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10356-ACGRBS15400
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10356-ACRRBS15400
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10356-ANGRBS15400
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10356-ANRRBS15400
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10356-CFRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10356-CHRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10356-CMRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10356-CYRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин клон кДНК в вектор клонированияHG10356-MRBS5130
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10356-M-NRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10356-NFRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10356-NHRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10356-NMRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10356-NYRBS13340
Человек Survivin/BIRC5/API4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10356-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

BIRC5, also known as Survivin and EPR-1, is a member of the IAP family. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but BIRC5 has only a single BIR domain. It is expressed cell cycle-dependently and highly expressed at mitosis. As a multitasking protein, BIRC5 has dual roles in promoting cell proliferation and preventing apoptosis. Survivin is a component of a chromosome passage protein complex (CPC) which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as an important regulator of the localization of this complex. It may counteract a default induction of apoptosis in G2/M phase.

  • Altieri DC. 1994, J Biol Chem. 269 (5): 3139-42.
  • Bouchard BA. et al., 2002, Thromb Haemost. 86 (4): 1133-5.
  • Yao XQ. et al., 2004, World J Gastroenterol. 10 (9): 1262-7.
  • Size / Price
    Каталог: HG10356-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human BIRC5 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
    • Human FetuinA / AHSG ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.