BIK cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

BIK cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
483 bp
Description
Full length Clone DNA of Human BCL2-interacting killer (apoptosis-inducing) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BIK cDNA ORF Clone, Human, C-Myc tag: Alternative Names

BIP1 cDNA ORF Clone, Human; BP4 cDNA ORF Clone, Human; NBK cDNA ORF Clone, Human

BIK Background Information

The BIN1 protein, which is encoded by the BIN1 gene, belongs to Myc-interacting protein family which is one of the nucleocytoplasmic adaptor proteins. The BIN1 protein can interact with the functionally critically Myc-box region at the N-terminal of the Myc oncoprotein, with a feature of tumor suppressor. Myc family proteins promote proliferation, growth, and apoptosis and, when deregulated, are profoundly involved in the genesis of an extraordinarily wide range of cancers. Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally significant because ectopic expression of BIN1 inhibited the growth of tumour cells lacking endogenous message. We conclude that BIN1 is an MYC-interacting protein with features of a tumour suppressor.
Full Name
BCL2-interacting killer (apoptosis-inducing)
References
  • Boyd J.M., et al.,(1995), Bik, a novel death-inducing protein shares a distinct sequence motif with Bcl-2 family proteins and interacts with viral and cellular survival-promoting proteins. Oncogene 11:1921-1928.
  • Han J., et al., (1996), Induction of apoptosis by human Nbk/Bik, a BH3-containing protein that interacts with E1B 19K.Mol. Cell. Biol. 16:5857-5864.
  • Hegde R., et al.,(1998), Blk, a BH3-containing mouse protein that interacts with Bcl-2 and Bcl-xL, is a potent death agonist.J. Biol. Chem. 273:7783-7786.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait