After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BID Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001196.2
Размер кДНК:588bp
Описание кДНК:Full length Clone DNA of Homo sapiens BH3 interacting domain death agonist with C terminal His tag.
Синоним гена:FP497, MGC15319, MGC42355, BID
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10468-ACGRBS15400
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10468-ACRRBS15400
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10468-ANGRBS15400
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10468-ANRRBS15400
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10468-CFRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10468-CHRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10468-CMRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10468-CYRBS13340
Человек p22 BID Джин клон кДНК в вектор клонированияHG10468-MRBS5130
Человек p22 BID Джин ORF экспрессии кДНК клона плазмидыHG10468-M-NRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10468-NFRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10468-NHRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10468-NMRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10468-NYRBS13340
Человек p22 BID Джин ORF экспрессии кДНК клона плазмидыHG10468-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

Ссылки
  • Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.
  • Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.
  • Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.
  • Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.
  • Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.
  • Size / Price
    Каталог: HG10468-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».