After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human BCL7C Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC019071
Размер кДНК:654bp
Описание кДНК:Full length Clone DNA of Homo sapiens B-cell CLL/lymphomA 7C.
Синоним гена:BCL7C
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14267-ACGRBS15400
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14267-ACRRBS15400
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14267-ANGRBS15400
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14267-ANRRBS15400
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14267-CFRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14267-CHRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14267-CMRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14267-CYRBS13340
Человек BCL7C Джин клон кДНК в вектор клонированияHG14267-GRBS5130
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14267-NFRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14267-NHRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14267-NMRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14267-NYRBS13340
Человек BCL7C Джин ORF экспрессии кДНК клона плазмидыHG14267-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14267-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».