After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BCL6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_138931
Размер кДНК:2121bp
Описание кДНК:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 6 with N terminal Flag tag.
Синоним гена:ZBTB27, LAZ3, BCL5, BCL6A
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12083-ACGRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12083-ACRRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12083-ANGRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12083-ANRRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12083-CFRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12083-CHRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12083-CMRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12083-CYRBS14710
Человек BCL6 Джин клон кДНК в вектор клонированияHG12083-GRBS5130
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12083-NFRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12083-NHRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12083-NMRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12083-NYRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмидыHG12083-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six C-terminal zinc-finger motifs and an N-terminal POZ domain. It has been reported that BCL-6 is present in DNA-binding complexes in nuclear extracts from various B-cell lines. There are many relationships between non-Hodgkin's lymphoma, diffuse large cell lymphoma and BCL6’s translocations. BCL6 can repress transcription from promoters linked to its DNA target sequence and this activity is dependent upon specific DNA-binding and the presence of an intact N-terminal half of the protein.

Ссылки
  • Ye BH, et al. (1997) The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature Genetics. 16: 161-70.
  • Seyfert VL, et al. (1996) Transcriptional repression by the proto-oncogene BCL-6. Oncogene. 12 (11) : 2331-42.
  • Chang CC, et al. (1996) BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. PNAS. 93 (14): 6947-52.
  • Size / Price
    Каталог: HG12083-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».