Быстрый заказ

Text Size:AAA

Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BCL6 Информация о продукте «Клон cDNA»
Размер кДНК:2121bp
Описание кДНК:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 6 with C terminal HA tag.
Синоним гена:ZBTB27, LAZ3, BCL5, BCL6A
Участок рестрикции:KpnI + NotI (6kb + 2.16kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human BCL6 Gene Plasmid Map
Human BCL6 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12083-ACGRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12083-ACRRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12083-ANGRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12083-ANRRBS16760
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12083-CFRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12083-CHRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12083-CMRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12083-CYRBS14710
Человек BCL6 Джин клон кДНК в вектор клонированияHG12083-GRBS5130
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12083-NFRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12083-NHRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12083-NMRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12083-NYRBS14710
Человек BCL6 Джин ORF экспрессии кДНК клона плазмидыHG12083-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six C-terminal zinc-finger motifs and an N-terminal POZ domain. It has been reported that BCL-6 is present in DNA-binding complexes in nuclear extracts from various B-cell lines. There are many relationships between non-Hodgkin's lymphoma, diffuse large cell lymphoma and BCL6’s translocations. BCL6 can repress transcription from promoters linked to its DNA target sequence and this activity is dependent upon specific DNA-binding and the presence of an intact N-terminal half of the protein.

  • Ye BH, et al. (1997) The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature Genetics. 16: 161-70.
  • Seyfert VL, et al. (1996) Transcriptional repression by the proto-oncogene BCL-6. Oncogene. 12 (11) : 2331-42.
  • Chang CC, et al. (1996) BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. PNAS. 93 (14): 6947-52.
  • Size / Price
    Каталог: HG12083-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human BCL6 ORF mammalian expression plasmid, C-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.