Быстрый заказ

Text Size:AAA

Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BCL2L1 Информация о продукте «Клон cDNA»
Размер кДНК:702bp
Описание кДНК:Full length Clone DNA of Homo sapiens BCL2-like 1 with C terminal His tag.
Синоним гена:BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, BCL-XL/S, DKFZp781P2092, BCL2L1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10455-ACGRBS15400
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10455-ACRRBS15400
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10455-ANGRBS15400
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10455-ANRRBS15400
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10455-CFRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10455-CHRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10455-CMRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10455-CYRBS13340
Человек BCL2L1/Bcl-XL Джин клон кДНК в вектор клонированияHG10455-MRBS5130
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмидыHG10455-M-NRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10455-NFRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10455-NHRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10455-NMRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10455-NYRBS13340
Человек BCL2L1/Bcl-XL Джин ORF экспрессии кДНК клона плазмидыHG10455-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

B-cell lymphoma-extra large (Bcl-xl) is a transmembrane molecule in the mitochondria. Bcl-xL (BCL2L1) , belongs to the Bcl-2 family. Members of the bcl-2 family encode proteins that function either to promote or to inhibit apoptosis. Antiapoptotic members such as Bcl-2 and Bcl-xL prevent PCD in response to a wide variety of stimuli to take part in cancer survival. Conversely, proapoptotic proteins, exemplified by Bax and Bak, can accelerate death and in some instances are sufficient to cause apoptosis independent of additional signals. The crystal and solution structures of a Bcl-2 family member, Bcl-xL is like this: The structures consist of two central, primarily hydrophobic α-helices, which are surrounded by amphipathic helices. A 60-residue loop connecting helices αl and α2 was found to be flexible and non-essential for anti-apoptotic activity. Bcl-xL is chareacterized as important factors in autophagy, inhibiting Beclin 1-mediated autophagy by binding to Beclin 1. In addition, Beclin 1, Bcl-2 and Bcl-xL can cooperate with Atg5 or Ca2+ to regulate both autophagy and apoptosis. Bcl-xL is also implicated in anoxia induced cell death. The pathway is initiated by the loss of function of the prosurvival Bcl-2 family members Mcl-1 and Bcl-2 / Bcl-XL, resulting in Bax- or Bak-dependent release of cytochrome c and subsequent caspase-9-dependent cell death. Thus, Bcl-xL, the well-characterized apoptosis guards, appears to be important in cell death.

  • Vander Heiden MG, et al. (1997) Bcl-xL Regulates the Membrane Potential and Volume Homeostasis of Mitochondria. Cell. 91 (5): 627-37.
  • Muchmore SW, et al. (1996) X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature. 381: 335-341.
  • SharoffEH, et al. (2007) Bcl-2 family members regulate anoxia-induced cell death. Antioxid Redox Signal. 9 (9) :1405-9.
  • Zhou F, et al. (2011) Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 278 (3): 403-13.
  • Size / Price
    Каталог: HG10455-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.