After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human BCDIN3D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC053560
Размер кДНК:879bp
Описание кДНК:Full length Clone DNA of Homo sapiens BCDIN3 domain containing DNA.
Синоним гена:BCDIN3D
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15250-ACGRBS15400
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15250-ACRRBS15400
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15250-ANGRBS15400
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15250-ANRRBS15400
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15250-CFRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15250-CHRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15250-CMRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15250-CYRBS13340
Человек BCDIN3D Джин клон кДНК в вектор клонированияHG15250-GRBS5130
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15250-NFRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15250-NHRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15250-NMRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15250-NYRBS13340
Человек BCDIN3D Джин ORF экспрессии кДНК клона плазмидыHG15250-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15250-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».