After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human BCAP29 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC008478
Размер кДНК:726bp
Описание кДНК:Full length Clone DNA of Homo sapiens B-cell receptor-associated protein 29.
Синоним гена:BAP29, DKFZp686M2086, FLJ53907, BCAP29
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14247-ACGRBS15400
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14247-ACRRBS15400
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14247-CFRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14247-CHRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14247-CMRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14247-CYRBS13340
Человек BAP29 Джин клон кДНК в вектор клонированияHG14247-GRBS5130
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14247-NFRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14247-NHRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14247-NMRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14247-NYRBS13340
Человек BAP29 Джин ORF экспрессии кДНК клона плазмидыHG14247-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14247-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».