Быстрый заказ

Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек BBS4 Информация о продукте «Клон cDNA»
    Размер кДНК:1560bp
    Описание кДНК:Full length Clone DNA of Homo sapiens Bardet-Biedl syndrome 4 with C terminal HA tag.
    Синоним гена:BBS4
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with BBS4 qPCR primers for gene expression analysis, HP100518 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10497-ACGRBS16760
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10497-ACRRBS16760
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10497-ANGRBS16760
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10497-ANRRBS16760
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10497-CFRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10497-CHRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10497-CMRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10497-CYRBS14710
    Человек BBS4 Джин клон кДНК в вектор клонированияHG10497-MRBS5130
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10497-M-FRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10497-NFRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10497-NHRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10497-NMRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10497-NYRBS14710
    Человек BBS4 Джин ORF экспрессии кДНК клона плазмидыHG10497-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10497-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.