BBS1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10498-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All BBS1 Reagents

CRO Services

Product recommended


All BBS1 Reagents

BBS1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1782 bp
Description
Full length Clone DNA of Human Bardet-Biedl syndrome 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BBS1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

BBS2L2 cDNA ORF Clone, Human

BBS1 Background Information

Full Name
Bardet-Biedl syndrome 1

BBS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BBS1 cDNA ORF Clone in Cloning Vector, Mouse MG50777-G
BBS1 cDNA ORF Clone, Mouse, untagged MG50777-UT
BBS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50777-ACGLN
BBS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50777-ACG
BBS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50777-ANG
BBS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50777-ACR
BBS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50777-ANR
BBS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50777-CF
BBS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50777-NF
BBS1 cDNA ORF Clone, Mouse, C-His tag MG50777-CH
BBS1 cDNA ORF Clone, Mouse, N-His tag MG50777-NH
BBS1 cDNA ORF Clone, Mouse, C-HA tag MG50777-CY
BBS1 cDNA ORF Clone, Mouse, N-HA tag MG50777-NY
BBS1 cDNA ORF Clone, Mouse, C-Myc tag MG50777-CM
BBS1 cDNA ORF Clone, Mouse, N-Myc tag MG50777-NM
BBS1 qPCR Primer Pairs, Mouse MP200751

BBS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BBS1 cDNA ORF Clone in Cloning Vector, Human HG10498-M
BBS1 cDNA ORF Clone, Human, untagged HG10498-UT
BBS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10498-ACGLN
BBS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10498-ACG
BBS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10498-ANG
BBS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10498-ACR
BBS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10498-ANR
BBS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10498-CF
BBS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10498-NF
BBS1 cDNA ORF Clone, Human, C-His tag HG10498-CH
BBS1 cDNA ORF Clone, Human, N-His tag HG10498-NH
BBS1 cDNA ORF Clone, Human, C-HA tag HG10498-CY
BBS1 cDNA ORF Clone, Human, N-HA tag HG10498-NY
BBS1 cDNA ORF Clone, Human, C-Myc tag HG10498-CM
BBS1 qPCR Primer Pairs, Human HP100519
info info
添加购物车成功! 添加购物车失败!