Быстрый заказ

Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human BBS1 Информация о продукте «Клон cDNA»
Размер кДНК:1782bp
Описание кДНК:Full length Clone DNA of Homo sapiens Bardet-Biedl syndrome 1 with C terminal HA tag.
Синоним гена:BBS2L2, FLJ23590, MGC51114, MGC126183, MGC126184
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10498-ACGRBS16760
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10498-ACRRBS16760
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10498-ANGRBS16760
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10498-ANRRBS16760
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10498-CFRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10498-CHRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10498-CMRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10498-CYRBS14710
Человек BBS1 Джин клон кДНК в вектор клонированияHG10498-MRBS5130
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10498-NFRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10498-NHRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10498-NMRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10498-NYRBS14710
Человек BBS1 Джин ORF экспрессии кДНК клона плазмидыHG10498-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10498-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.