After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human B4GALT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001497.3
Размер кДНК:1197bp
Описание кДНК:Full length Clone DNA of Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 with N terminal Flag tag.
Синоним гена:GT1, GTB, GGTB2, B4GAL-T1, MGC50983, beta4Gal-T1, DKFZp686N19253, B4GALT1
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11220-ACGRBS15400
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11220-ACRRBS15400
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11220-CFRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11220-CHRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11220-CMRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11220-CYRBS13340
Человек B4GALT1/GGTB2 Джин клон кДНК в вектор клонированияHG11220-MRBS5130
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11220-NFRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11220-NHRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11220-NMRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11220-NYRBS13340
Человек B4GALT1/GGTB2 Джин ORF экспрессии кДНК клона плазмидыHG11220-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose to oligosaccharides. They have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. B4GALT1 gene directs production of B4GALT1 protein using either of two transcription start sites. The product of the smaller transcript serves the traditional biosynthetic role in the Golgi. This form also complexes with α-lactalbumin, a mammary-specific protein, to form lactose synthase. In addition to a biosynthetic role, the protein translated from the longer transcript appears on the plasma membranes of some cells where it serves as a signalling receptor in cell-matrix interactions such as sperm-egg binding.

Ссылки
  • Hennet T. (2002) The galactosyltransferase family. Cellular and Molecular Life Sciences. 59(7): 1081-95.
  • Landers EA, et al. (2009) Porcine 1, 4-Galactosyltransferase-I Sequence and Expression. Reproduction in Domestic Animals. 44(2): 228-34.
  • Amado M, et al. (2000) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta. 1473 (1): 35-53.
  • Size / Price
    Каталог: HG11220-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».