Быстрый заказ

Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек B3GALT4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC032574
    Размер кДНК:1137bp
    Описание кДНК:Full length Clone DNA of Homo sapiens UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 with C terminal Myc tag.
    Синоним гена:GALT2, GALT4, BETA3GALT4
    Виды:Human
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with B3GALT4 qPCR primers for gene expression analysis, HP103381 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14748-ACGRBS15400
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14748-ACRRBS15400
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14748-CFRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14748-CHRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14748-CMRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14748-CYRBS13340
    Человек B3GALT4 Джин клон кДНК в вектор клонированияHG14748-GRBS5130
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14748-NFRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14748-NHRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14748-NMRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14748-NYRBS13340
    Человек B3GALT4 Джин ORF экспрессии кДНК клона плазмидыHG14748-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14748-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».