After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ANGPTL4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_139314.1
Размер кДНК:1221bp
Описание кДНК:Full length Clone DNA of Homo sapiens angiopoietin-like 4, transcript variant 1 with N terminal Flag tag.
Синоним гена:NL2, ARP4, FIAF, PGAR, HFARP, pp1158, ANGPTL2
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10563-ACGRBS15400
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10563-ACRRBS15400
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10563-CFRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10563-CHRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10563-CMRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10563-CYRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин клон кДНК в вектор клонированияHG10563-MRBS5130
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10563-M-FRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10563-NFRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10563-NHRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10563-NMRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10563-NYRBS13340
Человек ANGPTL4 / angiopoietin-like Белок 4 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10563-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

Ссылки
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Каталог: HG10563-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».