Angiogenin cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

Angiogenin cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
489 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiogenin, ribonuclease, RNase A family, 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.49kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Angiogenin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiogenin cDNA ORF Clone, Human, C-His tag: Validated Images

Angiogenin cDNA ORF Clone, Human, C-His tag: Alternative Names

ALS9 cDNA ORF Clone, Human; HEL168 cDNA ORF Clone, Human; RAA1 cDNA ORF Clone, Human; RNASE4 cDNA ORF Clone, Human; RNASE5 cDNA ORF Clone, Human

Angiogenin Background Information

Angiogenin is a protein crucial in angiogenesis, and it is overexpressed in many cancers and downregulated in neurodegenerative diseases, respectively. The protein interaction with actin, through the loop encompassing the 6-68 residues, is an essential step in the cellular cytoskeleton reorganization. This, in turn, influences the cell proliferation and migration processes. Angiogenin (ANG) is a secretory ribonuclease that promotes the proliferation of endothelial cells, leading to angiogenesis. This function relies on its ribonucleolytic activity, which is low for simple RNA substrates. Upon entry into the cytosol, ANG is sequestered by the ribonuclease inhibitor protein (RNH1). ANG is a potent cytotoxin for RNH1-knockout HeLa cells, belying its inefficiency as a nonspecific catalyst. The toxicity does, however, rely on the ribonucleolytic activity of ANG and a cytosolic localization, which lead to the accumulation of particular tRNA fragments (tRFs), such as tRF-5 Gly-GCC. These up-regulated tRFs are highly cytotoxic at physiological concentrations. Although ANG is well-known for its promotion of cell growth. Angiogenin and osteoprotegerin are triceps specific myokines with beta-cell protective actions against proinflammatory cytokines. Angiogenin and EPCs are modulated by rehabilitation after cerebral ischemia, suggesting that both angiogenin and EPCs could serve as biomarkers of improvement during rehabilitation or future therapeutic targets.
Full Name
angiogenin, ribonuclease, RNase A family, 5
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait