After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human AZU1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001700.3
Размер кДНК:756bp
Описание кДНК:Full length Clone DNA of Homo sapiens azurocidin 1.
Синоним гена:AZU, HBP, NAZC, AZAMP, CAP37, HUMAZUR, AZU1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-AZU1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.76kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 165C>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human AZU1 Gene Plasmid Map
Human AZU1 / HBP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10660-ACGRBS15400
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10660-ACRRBS15400
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10660-CFRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10660-CHRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10660-CMRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10660-CYRBS13340
Человек Azurocidin / CAP37 Джин клон кДНК в вектор клонированияHG10660-MRBS5130
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10660-NFRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10660-NHRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10660-NMRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10660-NYRBS13340
Человек Azurocidin / CAP37 Джин ORF экспрессии кДНК клона плазмидыHG10660-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Azurocidin (AZU1), also known as heparin-binding protein (HBP) or cationic antimicrobial protein 37 (CAP37), is an azurophil granule antibiotic protein, with monocyte chemotactic and antibacterial activity. The Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. Azurocidin is a member of the serine protease family that includes Cathepsin G, neutrophil elastase (NE), and proteinase 3 (PR3), however, Azurocidin is not a serine proteinase since the active site serine and histidine residues are replaced. Neutrophils arriving first at sites of inflammation release Azurocidin, which acts in a paracrine fashion on endothelial cells causing the development of intercellular gaps and allowing leukocyte extravasation. It thus be regarded as a reasonable therapeutic target for a variety of inflammatory disease conditions.

Ссылки
  • Lindmark A, et al. (1999) Characterization of the biosynthesis, processing, and sorting of human HBP/CAP37/azurocidin. J Leukoc Biol. 66(4): 634-43.
  • Heinzelmann M, et al. (2001) Heparin binding protein (CAP37) differentially modulates endotoxin-induced cytokine production. Int J Surg Investig. 2(6): 457-66.
  • Soehnlein O, et al. (2005) Neutrophil-derived heparin-binding protein (HBP/CAP37) deposited on endothelium enhances monocyte arrest under flow conditions. J Immunol. 174(10): 6399-405.
  • Size / Price
    Каталог: HG10660-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human AZU1 / HBP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».