After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATXN2 Информация о продукте «Клон cDNA»
Размер кДНК:3021bp
Описание кДНК:Full length Clone DNA of Homo sapiens ataxin 2 with N terminal His tag.
Синоним гена:ATX2, SCA2, ASL13, TNRC13
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15977-ACGRBS22240
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15977-ACRRBS22240
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15977-ANGRBS22240
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15977-ANRRBS22240
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15977-CFRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15977-CHRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15977-CMRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15977-CYRBS20190
Человек ATXN2/ATX2 Джин клон кДНК в вектор клонированияHG15977-GRBS5130
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15977-NFRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15977-NHRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15977-NMRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15977-NYRBS20190
Человек ATXN2/ATX2 Джин ORF экспрессии кДНК клона плазмидыHG15977-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15977-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.