ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag

Cat: HG13997-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ATPase Inhibitory Factor 1 Reagents

CRO Services

Product recommended


All ATPase Inhibitory Factor 1 Reagents

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
321 bp
Description
Full length Clone DNA of Human ATPase inhibitory factor 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag Alternative Names

ATPI cDNA ORF Clone, Human;ATPIP cDNA ORF Clone, Human;IP cDNA ORF Clone, Human

ATPase Inhibitory Factor 1 Background Information

Full Name
ATPase inhibitory factor 1

ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATPase Inhibitory Factor 1 cDNA ORF Clone in Cloning Vector, Mouse MG51315-U
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, untagged MG51315-UT
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51315-ACG
ATPase Inhibitory Factor 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51315-ACGLN
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51315-ANG
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51315-ACR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51315-ANR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51315-CF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51315-NF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-His tag MG51315-CH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-His tag MG51315-NH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-HA tag MG51315-CY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-HA tag MG51315-NY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, C-Myc tag MG51315-CM
ATPase Inhibitory Factor 1 cDNA ORF Clone, Mouse, N-Myc tag MG51315-NM
ATPase Inhibitory Factor 1 qPCR Primer Pairs, Mouse MP201192

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATPase Inhibitory Factor 1 cDNA ORF Clone in Cloning Vector, Human HG13997-G
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, untagged HG13997-UT
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13997-ACG
ATPase Inhibitory Factor 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13997-ACGLN
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13997-ANG
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13997-ACR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13997-ANR
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13997-CF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13997-NF
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-His tag HG13997-CH
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-HA tag HG13997-CY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-HA tag HG13997-NY
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, C-Myc tag HG13997-CM
ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-Myc tag HG13997-NM
ATPase Inhibitory Factor 1 qPCR Primer Pairs, Human HP102653
info info
添加购物车成功! 添加购物车失败!