Быстрый заказ

Text Size:AAA

Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP6V1F Информация о продукте «Клон cDNA»
Размер кДНК:360bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F with C terminal Myc tag.
Синоним гена:VATF, Vma7, ATP6S14
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15605-ACGRBS15400
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15605-ACRRBS15400
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15605-ANGRBS15400
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15605-ANRRBS15400
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15605-CFRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15605-CHRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15605-CMRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15605-CYRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин клон кДНК в вектор клонированияHG15605-GRBS5130
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15605-NFRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15605-NHRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15605-NMRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15605-NYRBS13340
Человек ATP6V1F/V-ATPase subunit F Джин ORF экспрессии кДНК клона плазмидыHG15605-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15605-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.