Быстрый заказ

Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP6V1B2 Информация о продукте «Клон cDNA»
Размер кДНК:1536bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 with C terminal HA tag.
Синоним гена:HO57, VATB, VPP3, Vma2, ATP6B2, ATP6B1B2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16366-ACGRBS16764
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16366-ACRRBS16760
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16366-ANGRBS16764
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16366-ANRRBS16760
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16366-CFRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16366-CHRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16366-CMRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16366-CYRBS14711
Человек ATP6V1B2 Джин клон кДНК в вектор клонированияHG16366-GRBS5132
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16366-NFRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16366-NHRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16366-NMRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16366-NYRBS14711
Человек ATP6V1B2 Джин ORF экспрессии кДНК клона плазмидыHG16366-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16366-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.