After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP6V0E1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003945.3
Размер кДНК:246bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1.
Синоним гена:M9.2, ATP6H, Vma21, Vma21p, ATP6V0E
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16151-ACGRBS15400
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16151-ACRRBS15400
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16151-CFRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16151-CHRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16151-CMRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16151-CYRBS13340
Человек ATP6V0E Джин клон кДНК в вектор клонированияHG16151-GRBS5130
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16151-NFRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16151-NHRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16151-NMRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16151-NYRBS13340
Человек ATP6V0E Джин ORF экспрессии кДНК клона плазмидыHG16151-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16151-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».