After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP6V0D1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_004691.4
Размер кДНК:1056bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1.
Синоним гена:P39, VATX, VMA6, ATP6D, ATP6DV, VPATPD
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16156-ACGRBS15400
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16156-ACRRBS15400
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16156-CFRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16156-CHRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16156-CMRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16156-CYRBS13340
Человек ATP6V0D1/VPATPD Джин клон кДНК в вектор клонированияHG16156-GRBS5130
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16156-NFRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16156-NHRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16156-NMRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16156-NYRBS13340
Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмидыHG16156-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16156-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».