Быстрый заказ

Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ATP6V0D1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_004691.4
    Размер кДНК:1056bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1.
    Синоним гена:P39, VATX, VMA6, ATP6D, ATP6DV, VPATPD
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATP6V0D1 qPCR primers for gene expression analysis, HP104925 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16156-ACGRBS15400
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16156-ACRRBS15400
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16156-CFRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16156-CHRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16156-CMRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16156-CYRBS13340
    Человек ATP6V0D1/VPATPD Джин клон кДНК в вектор клонированияHG16156-GRBS5130
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16156-NFRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16156-NHRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16156-NMRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16156-NYRBS13340
    Человек ATP6V0D1/VPATPD Джин ORF экспрессии кДНК клона плазмидыHG16156-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16156-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».