After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP5F1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005366
Размер кДНК:771bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1.
Синоним гена:RP11-552M11.5, MGC24431, PIG47, ATP5F1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14249-ACGRBS15400
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14249-ACRRBS15400
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14249-ANGRBS15400
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14249-ANRRBS15400
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14249-CFRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14249-CHRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14249-CMRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14249-CYRBS13340
Человек ATP5F1 Джин клон кДНК в вектор клонированияHG14249-GRBS5130
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14249-NFRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14249-NHRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14249-NMRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14249-NYRBS13340
Человек ATP5F1 Джин ORF экспрессии кДНК клона плазмидыHG14249-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14249-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».