Быстрый заказ

Text Size:AAA

Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP5D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC002389
Размер кДНК:507bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit with N terminal HA tag.
Синоним гена:ATP5D
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14630-ACGRBS15400
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14630-ACRRBS15400
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14630-ANGRBS15400
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14630-ANRRBS15400
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14630-CFRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14630-CHRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14630-CMRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14630-CYRBS13340
Человек ATP5D Джин клон кДНК в вектор клонированияHG14630-GRBS5130
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14630-NFRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14630-NHRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14630-NMRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14630-NYRBS13340
Человек ATP5D Джин ORF экспрессии кДНК клона плазмидыHG14630-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ATP5D is a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase consists of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). ATP5D gene encodes the delta subunit of the catalytic core.

Ссылки
  • Jordan EM. et al., 1992, Biochim Biophys Acta 1130 (1): 123-6.
  • Yoshida M. et al., 2001, Nat Rev Mol Cell Biol. 2 (9): 669-77.
  • Hochstrasser DF. et al., 1993, Electrophoresis. 13 (12): 992-1001.
  • Size / Price
    Каталог: HG14630-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».