Быстрый заказ

Text Size:AAA

Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP5B Информация о продукте «Клон cDNA»
Размер кДНК:1590bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide with N terminal His tag.
Синоним гена:ATPMB, ATPSB
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14844-ACGRBS16760
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14844-ACRRBS16760
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14844-ANGRBS16760
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14844-ANRRBS16760
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14844-CFRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14844-CHRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14844-CMRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14844-CYRBS14710
Человек ATP5B Джин клон кДНК в вектор клонированияHG14844-GRBS5130
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14844-NFRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14844-NHRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14844-NMRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14844-NYRBS14710
Человек ATP5B Джин ORF экспрессии кДНК клона плазмидыHG14844-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14844-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.