ATP1B1 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ATP1B1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Human ATPase, NA+/K+ transporting, beta 1 polypeptide with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ATP1B1 cDNA ORF Clone, Human, N-His tag: Alternative Names

ATP1B cDNA ORF Clone, Human

ATP1B1 Background Information

ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. ATP1B1 is a subunit of Na+/K+-ATPase. Na+/K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. Na+/K+-ATPase is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). ATP1B1 regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. ATP1B1 is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with which catalyzes the hydrolysis of ATP coupled with the exchange of Na+ and K+ ions across the plasma membrane.
Full Name
ATPase, Na+/K+ transporting, beta 1 polypeptide
References
  • Lingrel JB. et al., 1990, Prog Nucleic Acid Res Mol Biol. 38: 37-89.
  • Oakey RJ. et al., 1993, Hum Mol Genet. 1 (8): 613-20.
  • Ushkaryov YuA. et al., 1990, FEBS Lett. 257 (2): 439-42.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait