After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATP1B1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000006
Размер кДНК:912bp
Описание кДНК:Full length Clone DNA of Homo sapiens ATPase, NA+/K+ transporting, beta 1 polypeptide.
Синоним гена:ATP1B, MGC1798, ATP1B1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14255-ACGRBS15400
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14255-ACRRBS15400
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14255-CFRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14255-CHRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14255-CMRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14255-CYRBS13340
Человек ATP1B1 Джин клон кДНК в вектор клонированияHG14255-GRBS5130
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14255-NFRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14255-NHRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14255-NMRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14255-NYRBS13340
Человек ATP1B1 Джин ORF экспрессии кДНК клона плазмидыHG14255-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. ATP1B1 is a subunit of Na+/K+-ATPase. Na+/K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. Na+/K+-ATPase is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). ATP1B1 regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. ATP1B1 is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with which catalyzes the hydrolysis of ATP coupled with the exchange of Na+ and K+ ions across the plasma membrane.

Ссылки
  • Lingrel JB. et al., 1990, Prog Nucleic Acid Res Mol Biol. 38: 37-89.
  • Oakey RJ. et al., 1993, Hum Mol Genet. 1 (8): 613-20.
  • Ushkaryov YuA. et al., 1990, FEBS Lett. 257 (2): 439-42.
  • Size / Price
    Каталог: HG14255-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».