Быстрый заказ

Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATF4 Информация о продукте «Клон cDNA»
Размер кДНК:1056bp
Описание кДНК:Full length Clone DNA of Homo sapiens activating transcription factor 4 (tax-responsive enhancer element B67) with C terminal His tag.
Синоним гена:CREB2, TXREB, CREB-2, TAXREB67, ATF4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11124-ACGRBS15400
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11124-ACRRBS15400
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11124-ANGRBS15400
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11124-ANRRBS15400
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11124-CFRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11124-CHRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11124-CMRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11124-CYRBS13340
Человек ATF-4 Джин клон кДНК в вектор клонированияHG11124-MRBS5130
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11124-M-FRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11124-NFRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11124-NHRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11124-NMRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11124-NYRBS13340
Человек ATF-4 Джин ORF экспрессии кДНК клона плазмидыHG11124-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11124-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.